下面列出了java.io.File#createTempFile ( ) 实例代码,或者点击链接到github查看源代码,也可以在右侧发表评论。
static OutputStream getDumpStream(String name, int seq, String ext, Object b) throws IOException {
if (dumpDir == null) {
dumpDir = File.createTempFile("BD_", "", new File("."));
dumpDir.delete();
if (dumpDir.mkdir())
Utils.log.info("Dumping bands to "+dumpDir);
}
name = name.replace('(', ' ').replace(')', ' ');
name = name.replace('/', ' ');
name = name.replace('*', ' ');
name = name.trim().replace(' ','_');
name = ((10000+seq) + "_" + name).substring(1);
File dumpFile = new File(dumpDir, name+ext);
Utils.log.info("Dumping "+b+" to "+dumpFile);
return new BufferedOutputStream(new FileOutputStream(dumpFile));
}
@Test
public void testNestedBinCond() throws Throwable {
File tmpFile = File.createTempFile("test", "txt");
PrintStream ps = new PrintStream(new FileOutputStream(tmpFile));
for(int i = 0; i < LOOP_COUNT; i++) {
ps.println(i + "\t" + i + "\t1");
}
ps.close();
pig.registerQuery("A=load '"
+ Util.encodeEscape(Util.generateURI(tmpFile.toString(), pig.getPigContext())) + "';");
String query = "A = foreach A generate (($0 < 10 or $0 < 9)?(($1 >= 5 and $1 >= 4) ? 2: 1) : 0);";
log.info(query);
pig.registerQuery(query);
Iterator<Tuple> it = pig.openIterator("A");
tmpFile.delete();
int count =0;
while(it.hasNext()) {
Tuple t = it.next();
Integer first = (Integer)t.get(0);
count+=first;
assertTrue(first == 1 || first == 2 || first == 0);
}
assertEquals("expected count of 15", 15, count);
}
@BeforeClass
public static void initializeTests() throws Exception {
File trustStoreFile = File.createTempFile("truststore", ".jks");
String sslEnabledDataCentersStr = "DC1,DC2,DC3";
Properties serverSSLProps = new Properties();
TestSSLUtils.addSSLProperties(serverSSLProps, sslEnabledDataCentersStr, SSLFactory.Mode.SERVER, trustStoreFile,
"server");
TestSSLUtils.addHttp2Properties(serverSSLProps, SSLFactory.Mode.SERVER, true);
Properties routerProps = getRouterProperties("DC1");
TestSSLUtils.addSSLProperties(routerProps, sslEnabledDataCentersStr, SSLFactory.Mode.CLIENT, trustStoreFile,
"router-client");
sslCluster = new MockCluster(serverSSLProps, false, SystemTime.getInstance());
MockNotificationSystem notificationSystem = new MockNotificationSystem(sslCluster.getClusterMap());
sslCluster.initializeServers(notificationSystem);
sslCluster.startServers();
MockClusterMap routerClusterMap = sslCluster.getClusterMap();
// MockClusterMap returns a new registry by default. This is to ensure that each node (server, router and so on,
// get a different registry. But at this point all server nodes have been initialized, and we want the router and
// its components, which are going to be created, to use the same registry.
routerClusterMap.createAndSetPermanentMetricRegistry();
testFramework = new RouterServerTestFramework(routerProps, routerClusterMap, notificationSystem);
routerMetricRegistry = routerClusterMap.getMetricRegistry();
}
@Test
public void whenUriDoesNotContainUrlNameMustReturnError() throws Exception {
//Prepare the SUT
File uniqueFile = File.createTempFile("webHookTest_", ".txt", new File("target"));
StaplerRequest staplerRequest = Mockito.mock(RequestImpl.class);
StaplerResponse staplerResponse = Mockito.mock(ResponseImpl.class);
when(staplerRequest.getHeader("X-Gogs-Event")).thenReturn("push");
when(staplerRequest.getQueryString()).thenReturn("job=myJob");
MockServletInputStream inputStream = new MockServletInputStream("body");
when(staplerRequest.getInputStream()).thenReturn(inputStream);
when(staplerRequest.getRequestURI()).thenReturn("/badUri/aaa");
//perform the testÎ
performDoIndexTest(staplerRequest, staplerResponse, uniqueFile);
//validate that everything was done as planed
verify(staplerResponse).setStatus(404);
String expectedOutput = "No payload or URI contains invalid entries.";
isExpectedOutput(uniqueFile, expectedOutput);
log.info("Test succeeded.");
}
static void setUp() throws Exception {
testarray = new float[1024];
for (int i = 0; i < 1024; i++) {
double ii = i / 1024.0;
ii = ii * ii;
testarray[i] = (float)Math.sin(10*ii*2*Math.PI);
testarray[i] += (float)Math.sin(1.731 + 2*ii*2*Math.PI);
testarray[i] += (float)Math.sin(0.231 + 6.3*ii*2*Math.PI);
testarray[i] *= 0.3;
}
test_byte_array = new byte[testarray.length*2];
AudioFloatConverter.getConverter(format).toByteArray(testarray, test_byte_array);
test_file = File.createTempFile("test", ".raw");
try (FileOutputStream fos = new FileOutputStream(test_file)) {
fos.write(test_byte_array);
}
}
public void testPreadBytes() throws Exception{
final String testString = "hello, world!";
byte[] bytesToWrite = testString.getBytes("UTF-8");
ByteBuffer buf = ByteBuffer.allocate(bytesToWrite.length);
File tmpFile = File.createTempFile("preadbug-", ".tmp");
tmpFile.deleteOnExit();
try (
FileOutputStream fos = new FileOutputStream(tmpFile)) {
fos.write(bytesToWrite);
}
try (
RandomAccessFile raf = new RandomAccessFile(tmpFile, "r");
FileChannel channel = raf.getChannel()) {
channel.read(buf, 0);
}
String dstString = new String(buf.array(), "UTF-8");
assertEquals(testString, dstString);
}
public static void main(String[] args) throws Exception {
for (int i = 0;; i++) {
try {
switch (i) {
case 0: new File((String)null); break;
case 1: new File((String)null, null); break;
case 2: new File((File)null, null); break;
case 3: File.createTempFile(null, null, null); break;
case 4: File.createTempFile(null, null); break;
case 5: new File("foo").compareTo(null); break;
case 6: new File("foo").renameTo(null); break;
default:
System.err.println();
return;
}
} catch (NullPointerException x) {
System.err.print(i + " ");
continue;
}
throw new Exception("NullPointerException not thrown (case " +
i + ")");
}
}
/**
* Test of getXmlConfigString method, of class com.sun.jmx.examples.scandir.ScanDirConfig.
*/
public void testGetXmlConfigString() throws Exception {
System.out.println("getXmlConfigString");
try {
final File file = File.createTempFile("testconf",".xml");
final ScanDirConfig instance = new ScanDirConfig(file.getAbsolutePath());
final ScanManagerConfig bean =
new ScanManagerConfig("testGetXmlConfigString");
final DirectoryScannerConfig dir =
new DirectoryScannerConfig("tmp");
dir.setRootDirectory(file.getParent());
bean.putScan(dir);
instance.setConfiguration(bean);
System.out.println("Expected: " + XmlConfigUtils.toString(bean));
System.out.println("Received: " +
instance.getConfiguration().toString());
assertEquals(XmlConfigUtils.toString(bean),
instance.getConfiguration().toString());
} catch (Exception x) {
x.printStackTrace();
throw x;
}
}
@Override
public void setUp() throws Exception {
tmpDir = File.createTempFile("tmp", "", new File("."));
tmpDir.delete();
tmpDir.mkdirs();
String treeSizeStr = System.getProperty("lsmtree.test.size");
treeSize = "large".equals(treeSizeStr) ? LARGE_TREE_SIZE : SMALL_TREE_SIZE;
}
public static void main(String[] args) throws Exception {
ConfigurableApplicationContext context =
SpringApplication.run(LogServiceApplication.class, args);
LogService logsService = context.getBean(LogService.class);
FileService fileService = context.getBean(FileService.class);
File tempFile = File.createTempFile("LogServiceApplication", ".tmp");
tempFile.deleteOnExit();
fileService.writeTo(tempFile.getAbsolutePath(), logsService.stream());
RatpackServer.start(server ->
server.handlers(chain ->
chain.all(ctx -> {
Publisher<String> logs = logsService.stream();
ServerSentEvents events = serverSentEvents(
logs,
event -> event.id(Objects::toString)
.event("log")
.data(Function.identity())
);
ctx.render(events);
})
)
);
}
@Before
public void setUp() throws IOException {
File file = File.createTempFile("stratum-chain", ".chain");
client = createMock(StratumClient.class);
expect(client.getHeadersQueue()).andStubReturn(null);
params = NetworkParameters.fromID(NetworkParameters.ID_UNITTESTNET);
//new CheckpointManager(params, new ByteArrayInputStream("TXT CHECKPOINTS 1\n0\n0\n".getBytes("UTF-8")))
store = new HeadersStore(params, file, null, null);
chain = new StratumChain(params, store, client);
}
@Test
public void testReadLines() throws Exception {
File file = File.createTempFile("junit", ".txt", new File("build"));
try (Writer fwr = new FileWriter(file)) {
fwr.write("line1\n");
fwr.write("line2");
}
List<String> lines = IOExt.readLines(file);
assertThat(lines).containsExactly("line1", "line2");
}
private File newBackupFile() throws IOException {
File dir = new File(conf.get("fs.s3.buffer.dir"));
if (!dir.exists() && !dir.mkdirs()) {
throw new IOException("Cannot create S3 buffer directory: " + dir);
}
File result = File.createTempFile("output-", ".tmp", dir);
result.deleteOnExit();
return result;
}
@Before
public void setup() throws IOException {
testData = new byte[128];
for (int x = 0; x < 128; x++) {
testData[x] = (byte) x;
}
tempFile = File.createTempFile("ra-fost", "tmp");
tempFile.deleteOnExit();
}
private void run(String keystoreType) throws Exception {
char[] pw = "password".toCharArray();
KeyStore ks = KeyStore.getInstance(keystoreType);
ks.load(null, pw);
KeyGenerator kg = KeyGenerator.getInstance("AES");
kg.init(128);
SecretKey key = kg.generateKey();
KeyStore.SecretKeyEntry ske = new KeyStore.SecretKeyEntry(key);
KeyStore.ProtectionParameter kspp = new KeyStore.PasswordProtection(pw);
ks.setEntry(ALIAS, ske, kspp);
File ksFile = File.createTempFile("test", ".test");
try (FileOutputStream fos = new FileOutputStream(ksFile)) {
ks.store(fos, pw);
fos.flush();
}
// now see if we can get it back
try (FileInputStream fis = new FileInputStream(ksFile)) {
KeyStore ks2 = KeyStore.getInstance(keystoreType);
ks2.load(fis, pw);
KeyStore.Entry entry = ks2.getEntry(ALIAS, kspp);
SecretKey keyIn = ((KeyStore.SecretKeyEntry)entry).getSecretKey();
if (Arrays.equals(key.getEncoded(), keyIn.getEncoded())) {
System.err.println("OK: worked just fine with " + keystoreType +
" keystore");
} else {
System.err.println("ERROR: keys are NOT equal after storing in "
+ keystoreType + " keystore");
}
}
}
public void testEarAssemblyToTempDir() throws Exception {
AssemblerConfig config = new AssemblerConfig();
config.setSource( earFile );
File assembledEar = File.createTempFile( earFile.getName(), ".ear" );
config.setDestination( assembledEar );
EarAssembler assembler = new EarAssembler();
assembler.assemble( config );
validateEarAssembly( assembledEar );
assembledEar.delete();
}
@ParameterizedTest
@MethodSource("data")
public void testAddIptcData(File imageFile) throws Exception {
final ByteSource byteSource = new ByteSourceFile(imageFile);
final Map<String, Object> params = new HashMap<>();
final boolean ignoreImageData = isPhilHarveyTestImage(imageFile);
params.put(ImagingConstants.PARAM_KEY_READ_THUMBNAILS, Boolean.valueOf(!ignoreImageData));
final JpegPhotoshopMetadata metadata = new JpegImageParser().getPhotoshopMetadata(byteSource, params);
if (metadata == null) {
// FIXME select only files with meta for this test
return;
}
final List<IptcBlock> newBlocks = new ArrayList<>(metadata.photoshopApp13Data.getNonIptcBlocks());
final List<IptcRecord> oldRecords = metadata.photoshopApp13Data.getRecords();
final List<IptcRecord> newRecords = new ArrayList<>();
for (final IptcRecord record : oldRecords) {
if (record.iptcType != IptcTypes.CITY
&& record.iptcType != IptcTypes.CREDIT) {
newRecords.add(record);
}
}
newRecords.add(new IptcRecord(IptcTypes.CITY, "Albany, NY"));
newRecords.add(new IptcRecord(IptcTypes.CREDIT, "William Sorensen"));
final PhotoshopApp13Data newData = new PhotoshopApp13Data(newRecords, newBlocks);
final File updated = File.createTempFile(imageFile.getName() + ".iptc.add.", ".jpg");
try (FileOutputStream fos = new FileOutputStream(updated);
OutputStream os = new BufferedOutputStream(fos)) {
new JpegIptcRewriter().writeIPTC(byteSource, os, newData);
}
final ByteSource updateByteSource = new ByteSourceFile(updated);
final JpegPhotoshopMetadata outMetadata = new JpegImageParser().getPhotoshopMetadata(
updateByteSource, params);
assertNotNull(outMetadata);
assertTrue(outMetadata.getItems().size() == newRecords.size());
}
/**
* Test add new BlobStore with given {@link ReplicaId}.
*/
@Test
public void addBlobStoreTest() throws Exception {
generateConfigs(true, false);
MockDataNodeId localNode = clusterMap.getDataNodes().get(0);
List<ReplicaId> localReplicas = clusterMap.getReplicaIds(localNode);
int newMountPathIndex = 3;
// add new MountPath to local node
File f = File.createTempFile("ambry", ".tmp");
File mountFile =
new File(f.getParent(), "mountpathfile" + MockClusterMap.PLAIN_TEXT_PORT_START_NUMBER + newMountPathIndex);
MockClusterMap.deleteFileOrDirectory(mountFile);
assertTrue("Couldn't create mount path directory", mountFile.mkdir());
localNode.addMountPaths(Collections.singletonList(mountFile.getAbsolutePath()));
PartitionId newPartition1 =
new MockPartitionId(10L, MockClusterMap.DEFAULT_PARTITION_CLASS, clusterMap.getDataNodes(), newMountPathIndex);
StorageManager storageManager = createStorageManager(localNode, metricRegistry, null);
storageManager.start();
// test add store that already exists, which should fail
assertFalse("Add store which is already existing should fail", storageManager.addBlobStore(localReplicas.get(0)));
// test add store onto a new disk, which should succeed
assertTrue("Add new store should succeed", storageManager.addBlobStore(newPartition1.getReplicaIds().get(0)));
assertNotNull("The store shouldn't be null because new store is successfully added",
storageManager.getStore(newPartition1, false));
// test add store whose diskManager is not running, which should fail
PartitionId newPartition2 =
new MockPartitionId(11L, MockClusterMap.DEFAULT_PARTITION_CLASS, clusterMap.getDataNodes(), 0);
storageManager.getDiskManager(localReplicas.get(0).getPartitionId()).shutdown();
assertFalse("Add store onto the DiskManager which is not running should fail",
storageManager.addBlobStore(newPartition2.getReplicaIds().get(0)));
storageManager.getDiskManager(localReplicas.get(0).getPartitionId()).start();
// test replica addition can correctly handle existing dir (should delete it and create a new one)
// To verify the directory has been recreated, we purposely put a test file in previous dir.
PartitionId newPartition3 =
new MockPartitionId(12L, MockClusterMap.DEFAULT_PARTITION_CLASS, clusterMap.getDataNodes(), 0);
ReplicaId replicaToAdd = newPartition3.getReplicaIds().get(0);
File previousDir = new File(replicaToAdd.getReplicaPath());
File testFile = new File(previousDir, "testFile");
MockClusterMap.deleteFileOrDirectory(previousDir);
assertTrue("Cannot create dir for " + replicaToAdd.getReplicaPath(), previousDir.mkdir());
assertTrue("Cannot create test file within previous dir", testFile.createNewFile());
assertTrue("Adding new store should succeed", storageManager.addBlobStore(replicaToAdd));
assertFalse("Test file should not exist", testFile.exists());
assertNotNull("Store associated new added replica should not be null",
storageManager.getStore(newPartition3, false));
shutdownAndAssertStoresInaccessible(storageManager, localReplicas);
// test add store but fail to add segment requirements to DiskSpaceAllocator. (This is simulated by inducing
// addRequiredSegments failure to make store inaccessible)
List<String> mountPaths = localNode.getMountPaths();
String diskToFail = mountPaths.get(0);
File reservePoolDir = new File(diskToFail, diskManagerConfig.diskManagerReserveFileDirName);
File storeReserveDir = new File(reservePoolDir, DiskSpaceAllocator.STORE_DIR_PREFIX + newPartition2.toString());
StorageManager storageManager2 = createStorageManager(localNode, new MetricRegistry(), null);
storageManager2.start();
Utils.deleteFileOrDirectory(storeReserveDir);
assertTrue("File creation should succeed", storeReserveDir.createNewFile());
assertFalse("Add store should fail if store couldn't start due to initializePool failure",
storageManager2.addBlobStore(newPartition2.getReplicaIds().get(0)));
assertNull("New store shouldn't be in in-memory data structure", storageManager2.getStore(newPartition2, false));
shutdownAndAssertStoresInaccessible(storageManager2, localReplicas);
}
@Test
public void testShortFragmentHardClipping() throws IOException {
final File output = File.createTempFile("testShortFragmentClipping", ".sam");
output.deleteOnExit();
final File alignedSam = new File(TEST_DATA_DIR, "hardclip.aligned.sam");
final File unmappedSam = new File(TEST_DATA_DIR, "hardclip.unmapped.sam");
final File ref = new File(TEST_DATA_DIR, "cliptest.fasta");
final List<String> args = Arrays.asList(
"UNMAPPED_BAM=" + unmappedSam.getAbsolutePath(),
"ALIGNED_BAM=" + alignedSam.getAbsolutePath(),
"OUTPUT=" + output.getAbsolutePath(),
"REFERENCE_SEQUENCE=" + ref.getAbsolutePath(),
"HARD_CLIP_OVERLAPPING_READS=true"
);
Assert.assertEquals(runPicardCommandLine(args), 0);
final SamReader result = SamReaderFactory.makeDefault().open(output);
final Map<String, SAMRecord> firstReadEncountered = new HashMap<String, SAMRecord>();
for (final SAMRecord rec : result) {
final SAMRecord otherEnd = firstReadEncountered.get(rec.getReadName());
if (otherEnd == null) {
firstReadEncountered.put(rec.getReadName(), rec);
} else {
final int fragmentStart = Math.min(rec.getAlignmentStart(), otherEnd.getAlignmentStart());
final int fragmentEnd = Math.max(rec.getAlignmentEnd(), otherEnd.getAlignmentEnd());
final String[] readNameFields = rec.getReadName().split(":");
// Read name of each pair includes the expected fragment start and fragment end positions.
final int expectedFragmentStart = Integer.parseInt(readNameFields[1]);
final int expectedFragmentEnd = Integer.parseInt(readNameFields[2]);
Assert.assertEquals(fragmentStart, expectedFragmentStart, rec.getReadName());
Assert.assertEquals(fragmentEnd, expectedFragmentEnd, rec.getReadName());
if (readNameFields[0].equals("FR_clip")) {
Assert.assertEquals(rec.getCigarString(), rec.getReadNegativeStrandFlag()? "20H56M" : "56M20H");
Assert.assertEquals(otherEnd.getCigarString(), otherEnd.getReadNegativeStrandFlag()? "20H56M" : "56M20H");
if (!rec.getReadNegativeStrandFlag()) {
Assert.assertEquals(rec.getAttribute("XB"), "AGATCGGAAGAGCACACGTC");
Assert.assertEquals(rec.getAttribute("XQ"), "BBBBB?BBB?<?A?<7<<=9");
} else {
Assert.assertEquals(rec.getAttribute("XB"), "AGATCGGAAGAGCGTCGTGT");
Assert.assertEquals(rec.getAttribute("XQ"), "[email protected]=CC:CCD");
}
} else {
Assert.assertEquals(rec.getCigarString(), "76M");
Assert.assertEquals(otherEnd.getCigarString(), "76M");
}
}
}
}
/**
* creates and deletes file, just for purpose of getting an temporary file name.
*
* @param prefix
* @return
* @throws IOException
*/
private File getTempFileName(String prefix) throws IOException {
File tempFile = File.createTempFile(prefix, "output");
delete(tempFile);
return tempFile;
}